User Tools

Site Tools


problem_0

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
problem_0 [2010/11/17 22:35]
ike
problem_0 [2014/01/18 07:44] (current)
Line 1: Line 1:
-====== ​Problem ​0 ======+====== ​Practice ​0 ======
  
 Cut out a piece of sequence from specific area of Mycoplasma genitalium whole genome and save it to a file. Cut out a piece of sequence from specific area of Mycoplasma genitalium whole genome and save it to a file.
 +
 ===== 0.1 - Genome file ===== ===== 0.1 - Genome file =====
  
-Various types of genome ​are saved in following directory.+First obtain a flatfile for //M. genitalium// ​genome ​(~0.6 Mbp).
  
-  ​/pub/sfc/dnadb/genomes/​bacteria/+<​code>​ 
 +wget http://rest.g-language.org/togoWS/NC_000908 
 +</code>
  
-Select a following directory for M. genitalium genome (~0.6 Mbp). 
- 
-  Mgen/​mgen.gbk 
 ===== 0.2 - Cutting out specific area of genome ===== ===== 0.2 - Cutting out specific area of genome =====
  
-If the cut out area were as follow+If the cut out areas were as follows:
  
   127178 - 128811,237246 - 239251   127178 - 128811,237246 - 239251
Line 27: Line 27:
   241 ctaataacaa tattattaca atatgctaga ataatattgc tagtatcaat aattactaat   241 ctaataacaa tattattaca atatgctaga ataatattgc tagtatcaat aattactaat
  
-Copy and paste DNA sequence form a genome file using text editor (emacs) and save it to a file.+Copy and paste DNA sequence form a genome file using text editor (such as emacs) and save it to a file.
  
   tcaatcaatacatatataatattattaaaatacttgataagtattatttagatattagacaaatactaattttatattgctttaatactta   tcaatcaatacatatataatattattaaaatacttgataagtattatttagatattagacaaatactaattttatattgctttaatactta
Line 35: Line 35:
   First sequence ​    ​Second sequence   First sequence ​    ​Second sequence
   11152 - 12140 , 136079 - 137367   11152 - 12140 , 136079 - 137367
-====== Preview of the Problem 1 ====== 
  
-===== Problem ​1-1 [Basic] =====+====== Preview of the Practice 1 ====== 
 + 
 +===== Practice ​1-1 [Basic] =====
 Write a program that counts all the number of each base from given specific area of genome. Write a program that counts all the number of each base from given specific area of genome.
  
  
-===== Problem ​1-2 [Basic] ===== +===== Practice ​1-2 [Basic] ===== 
-Refine previous program that enables to load whole genome sequence of M. genitalium and compare the sequential ​difference (bias) ​through nucleotide usage.+Refine previous program that enables to load whole genome sequence of //M. genitalium// and compare the compositional ​difference (bias).
  
  
-===== Problem ​1-3 [Advanced] ===== +===== Practice ​1-3 [Advanced] ===== 
-Doubled ​nucleotides are called dinucleotide and there are 16 types of nucleotides ​from four types base per single nucleotide. In the Problem ​1-3, modify previous program for dinucleotide frequency analysis. Check out the entire dinucleotide frequency pattern in the Mycoplasma genome and compare with the result for the Problem ​1-2.+Two-letter ​nucleotides are called dinucleotide and there are 16 types of nucleotides ​as a combination of four types of bases. In Practice ​1-3, modify ​the previous program for dinucleotide frequency analysis. Check out the entire dinucleotide frequency pattern in the //Mycoplasma// genome and compare with the result for the Practice ​1-2.
problem_0.txt · Last modified: 2014/01/18 07:44 (external edit)